WWW.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

Pages:     | 1 | 2 || 4 | 5 |   ...   | 8 |

«ISSN 1999-9127 Государственное научное учреждение «ИНСТИТУТ ГЕНЕТИКИ И ЦИТОЛОГИИ НАЦИОНАЛЬНОЙ АКАДЕМИИ НАУК БЕЛАРУСИ» МОЛЕКУЛЯРНАЯ И ПРИКЛАДНАЯ ...»

-- [ Страница 3 ] --

В качестве исходного материала использова- же условиях в течение 3-4 часов. Получен ли сорт льна-долгунца белорусской селекции ную суспензию применяли для инфициро Генно-инженерная конструкция была лю- В качестве эксплантов для трансформации безно предоставлена академиком Я.Б. Блюмом были использованы сегменты гипокотилей (Институт пищевой биотехнологии и геномики пятидневных проростков льна-долгунца НАН Украины) и представляла собой бинарный размером 3-4 мм, которые помещали на ага вектор pBITUBA8, содержащий мутантый ген ризованную среду МС-БН, и предкультиви -тубулина Тuаml из Еleusine indica [11] и ген ровали в течение 48 ч. Трансформацию и ко -тубулина HvTUBl из ячменя (Hordeum vulgare) культивирование с агробактерией проводили [12]. Оба гена интегрированы в конструкцию под согласно методу, описанному нами ранее контролем промотора 35S РНК вируса мозаики [18]. Затем экспланты помещали на среду цветной капусты (35S РНК СаМV) и октопино- МС-БН, содержащую антибиотик клафоран вого терминатора 3’OCS [13]. в концентрации 200 мг/л для ингибирования Выбор селективных концентраций трифлю- развития колоний агробактерий и канамицин ралина. Поскольку трифлюралин (DowElanco, в концентрации 100 мг/л для создания селек Greeneld, США) является одним из наиболее тивного давления на нетрансформированные эффективных представителей класса дини- клетки. Параллельно проводили селекцию троаналиновых гербицидов, нами проведен трансформированных тканей на селектив анализ чувствительности клеток каллуса льна ных концентрациях трифлюралина по анало к его действию, и установлена его летальная гичной схеме, т.е. вместо канамицина в среду концентрация. Концентрацию трифлюралина культивирования вносили трифлюралин в определяли с помощью теста in vitro [14, 15]. концентрации 3 мкМ. Выжившие и регене Для этого готовили 10 мМ стерильный раствор рировавшие в селективных условиях расте гербицида в диметилсульфоксиде и хранили ния переносили на безгормональную среду при -20°С. Затем соответствующие концентра- МС для укоренения [19, 20] и молекулярно ции трифлюралина (0,5-10 мкМ) добавляли в биологического анализа.

охлажденную стерильную питальную среду Молекулярно-генетический анализ. Для для каллусообразования льна. выделения тотальной ДНК из предполо Агробактериальная трансформация. Для жительно трансгенных побегов использо трансформации льна использовали ночную вали комплект реагентов «ДНК-сорб-С»

культуру агробактерии, которую выращива- (Россия). Целевые гены Тuаml и HvTUBl в ли на среде LB [16] с добавлением 100 мг/л используемой нами конструкции находят рифампицина и 100 мг/л канамицина при ся под контролем 35S промотора вируса температуре 28°С и постоянном качании на мозаики цветной капусты, который можно орбитальном шейкере (180 об/мин). Клетки идентифицировать с помощью праймеров агробактерии осаждали центрифугировани- к последовательности данного промотора.

ем (1000 об/мин) и разбавляли свежей жидкой Для этой цели использована тест-система средой МС [17] до достижения оптической «АмплиСенсR ПЛАНТ-СКРИН». Амплифи плотности OD600 = 0,5 и инкубировали в тех кацию и последующий анализ первичных Молекулярная и прикладная генетика. Том 12, 2011 г.

Е.В. Гузенко, В.А. Лемеш. Создание и анализ генетически модифицированных растений льна... трансформантов проводили согласно ин- праймеров к хромосомным генам агробак Для подтверждения интеграции маркер- 5’-TGCGCAGGTCGCTTGCTTC-3’.

ного гена в геном полученных растений- Реакции проходили в амплификаторе Bio регенерантов проводили ПЦР с праймерами к Rad при следующих условиях: шаг 1 – последовательности гена nptII (5`-CGACGTT- мин при 94°С;

шаг 2 – 29 циклов, 30 сек GTCACTGAAGCG-3` и 5`-AAGCACGAG- при 94°С, 1 мин при 56°С и 1 мин при 72°С;

GAAGCGGTCAG-3`). Размер амплифицируе- шаг 3 – 5 мин при 72°С. Продукты ПЦР раз Для доказательства того, что амплификация геле с добавлением этидиум бромида и до последовательности селективного маркера кументировали с помощью системы Bio-Rad происходит с геномной ДНК модифицирован- GelDoc2000. Размеры амплифицированных ных растений, а не с экспрессионного вектора, фрагментов определяли, используя в каче который встроен в плазмиду бактериальной стве маркера GeneRulerTM100 bp (1000 bp) клетки, проводилась ПЦР с использованием Plus DNA ladder (Fermentas).

Исследования, проведенные в Канаде [21], ков длиной 3-5 мм, которые помещали на Великобритании [22], Словакии [23] по- агаризованную среду МС-БН и предкульти зволили разработать различные способы и вировали в течение 48 ч. Наши наблюдения условия трансформации льна масличного. показали, что данный этап является обяза Аналогичные исследования на культуре тельным при проведении агробактериальной льна-долгунца единичны в силу того, что трансформации льна-долгунца. В противном эта культура обладает пониженной морфо- случае количество выживших эксплантов генетической активностью in vitro по срав- после трансформации резко снижается, а нению с другими разновидностями льна. в некоторых экспериментах погибают все Известно, что важной предпосылкой для экспланты. Для льна-долгунца еще недоста создания успешной системы трансформа- точно хорошо разработаны методы переноса ции какого-то определенного вида расте- генов. Существуют лишь единичные рабо ний является наличие высокоэффективной ты по использованию агробактериальной, системы регенерации побегов в культуре in ПЭГ-индуцированной и биобаллистической vitro. Ранее нами была проведена оценка трансформации [25, 26] для получения мо морфогенетического потенциала и регене- дифицированных растений льна-долгунца. В рационной способности некоторых сортов частности, в результате использования этих льна-долгунца, районированных в Бела- методов были созданы первичные растения руси, в культуре in vitro [24]. В результате трансформанты, несущие химерные или ан был определен гормональный состав пи- тисмысловые встройки [25, 27, 28], а также тательной среды, оптимальной для каллу- растения льна, продуцирующие новые ме сообразования и регенерации растений, и таболиты [29].





отобран ряд сортов белорусской селекции, Встраиваемая нами конструкция несла гены, обладающих высоким регенерационным кодирующие обе субъединицы гетеродимерного потенциалом [24]. Для данного исследова- белка тубулина: мутантый ген -субъединицы ния в качестве основного объекта был вы- (Тuаml) из природного высокоустойчивого к бран сорт льна-долгунца Старт. динитроанилинам биотипа гусиной травы и Для агротрансформации использовали сег- полноразмерный ген -субъединицы тубулина менты гипокотилей пятидневных пророст- (HvTUBl) из ячменя (рис.1).

44 Е.В. Гузенко, В.А. Лемеш. Создание и анализ генетически модифицированных растений льна...

LB и RB – левая и правая границы Т-ДНК, 35S – промотор 35S вируса мозаики цветной капусты, Тuаml – ген мутантного -тубулина, 3’OCS – октопиновый терминатор, HvTUBl – ген -тубулина, Pnos – нопалиновый промотор, nptII – ген устойчивости к канамицину, 3’nos – нопалиновый терминатор.

Предполагается, что наличие в конструкции его негативное влияние на органогенез. Чаще двух субъединиц и их последующая эквимо- всего концентрация канамицина при селек лярная коэкспрессия является необходимым ции трансформированных гипокотилей льна условием для обеспечения их корректного долгунца составляет 100 мг/л [30]. В наших встраивания в нативные интерфазные или ми- экспериментах большинство гипокотильных тотические микротрубочки трансформирован- сегментов, инокулированных бактериальной Отбор первичных трансформантов в нашем среду (Km100), замедляли рост, экспланты жел исследовании был основан на толерантности тели и засыхали. Однако у части эксплантов на модифицированных клеток и тканей как кана- срезах формировался и активно рос зеленый мицину за счет экспрессии в них гена nptII, так каллус плотной консистенции, что позволило и за счет экспрессии в клетках гена мутантного предполагать получение трансформированно тубулина, определяющего устойчивость к ди- го каллуса (рис. 2). Аналогичным способом нитроанилинам. Оптимальная концентрация через стадию формирования каллуса прово селективного агента должна минимизировать дили регенерацию трансформированных по процент регенерации нетрансформирован- бегов как масличного льна [22], так и льна ных растений и максимально ограничивать долгунца [30].

Рис. 2. Формирование каллуса из модифицированных клеток на селективной среде (Km100) Молекулярная и прикладная генетика. Том 12, 2011 г.

Е.В. Гузенко, В.А. Лемеш. Создание и анализ генетически модифицированных растений льна... Для установления эффективной селективной in vitro каллусов льна-долгунца. Полученные концентрации динитроанилинового гербици- нами данные коррелируют с результатами да (трифлюралин) каллусы культивировали на предыдущих исследований по установлению твердых средах, содержащих трифлюралин в критических микромолярных концентраций концентрациях 0,5-10 мкМ, так как ранее бы- этого гербицида для других видов некоторых ло показано, что динитроанилины проявляют однодольных [15] и двудольных [31] растений.

высокую антимикротрубочковую активность в В таблице представлены результаты эффектив растительных клетках при достаточно низких ности морфогенеза и регенерации гипокотиль микромолярных концентрациях [6]. В резуль- ных эксплантов сорта Старт после проведения тате наших исследований установлено, что агробактериальной трансформации и селек концентрация 3 мкМ является эффективной ции на средах, содержащих канамицин(Km100) концентрацией трифлюралина для селекции и трифлюралин (3 мкМ) (табл. 1).

Эффективность морфогенеза и регенерации после проведения агробактериальной При проведении селекции на среде, содер- эксплантов, образовавших каллус к количеству жащей 100 мг/л канамицина, спустя 3–4 не- сформировавшихся побегов составило 6,7 %.

дели после инокуляции 191-го сегмента гипо- В ходе экспериментов по агробактериаль котилей наблюдалось активное формирование ной трансформации гипокотильных сегмен каллусов по краям эксплантов. Несмотря на тов получено 12 первичных трансформантов легкость получения каллусных тканей, по- льна-долгунца сорта Старт. Рост побегов на лучить побеги льна-долгунца после проведе- средах, содержащих канамицин или трифлю ния трансформации не всегда удается. Тем не ралин, является косвенным доказательством менее, в результате культивирования жизне- их трансгенной природы. Для подтвержде способного каллуса на селективных средах с ния интеграции переносимых генов проведен канамицином сформировалось 8 побегов. Со- молекулярно-генетический анализ первичных отношение количества эксплантов, образовав- трансформантов. Поскольку и -, и -тубулины ших каллус к количеству сформировавшихся растений кодируются относительно большим побегов составило 7,3 %. Такой показатель количеством генов с очень схожими последо эффективности агробактериальной трансфор- вательностями, то специфическая амплифи мации характерен для льна [32, 33]. кация перенесенных генов из конструкции Селекция гипокотильных эксплантов на сре- pBITUBA8 в растения невозможна. Так как де, содержащей 3 мкМ трифлюралина, была целевые гены в использованной конструкции более продолжительной, чем на среде, содер- находятся под контролем 35S промотора, нами жащей в качестве селективного агента кана- проведена амплификация с соответствующи мицин. Образование каллуса на эксплантах ми праймерами. Результаты анализа показали наблюдали только спустя 2-3 месяца от начала наличие фрагментов, соответствующие пози культивирования, регенерация побегов также тивному контролю (плазмида pBITUBA8) во была затруднена. Соотношение количества всех образцах (рис. 3).

46 Е.В. Гузенко, В.А. Лемеш. Создание и анализ генетически модифицированных растений льна...

Рис. 3. Электрофореграмма продуктов амплификации с праймерами к 35S промотору (1 – 12 ДНК индиви дуальных растений-регенерантов льна-долгунца сорта Старт, 13 – положительный контроль (ДНК плазмиды pBITUBA8), К – отрицательный контроль ПЦР, М – маркер молекулярной массы 1000 пн).

(Km50). Культивирование на селективной среде того, что амплификация последовательности в условиях in vitro приводило к заметному угне- селективного маркера происходит с геномной тению способности к корнеобразованию у части ДНК генетически модифицированных расте растений. В итоге пять побегов дали корни. Для ний, а не с экспрессионного вектора, который способных расти на средах с антибиотиком, про- проведен анализ с использованием праймеров к веден ПЦР-анализ с праймерами к nptII гену, а хромосомным генам агробактерий. В результате также к хромосомным генам агробактерии. При трансгенный статус достоверно подтвержден у Рис. 4. Электрофореграмма продуктов амплификации с праймерами к хромосомным генам A.tumefaciens и к гену nptII (1 – ДНК плазмиды pBITUBA8, 2–6 – ДНК индивидуальных растений льна-долгунца).

Таким образом, комплексный молекулярно- трансгенный статус пяти истинных трансфор генетический скрининг методом ПЦР пер- мантов льна-долгунца.

вичных трансформантов льна-долгунца сорта Старт, полученных методом агробактериаль- Работа была выполнена при поддержке ной трансформации, позволил подтвердить БРФФИ (грант Б09К-053).

Молекулярная и прикладная генетика. Том 12, 2011 г.

Е.В. Гузенко, В.А. Лемеш. Создание и анализ генетически модифицированных растений льна... 1. Flax / A. Pretova [et al.] // Biotechnology Генетика. – Т. 45, № 10. – С. 1377–1385.

in Agriculture and Forestry. – 2007. – Vol. 6. – 14. Transfer of amiprophosmethyl–resistance 2. Mitotic disrupter herbicide: recent advanc- matic hybridization / A.I. Yemets [et al.] // The es and opportunities / W.T. Molin [et al.] // Her- or. Appl. Genet. – 2000. – V. 100. – P. 847–857.

bicide Activity: Toxicology, Biochemistry and 15. Efcient callus formation and plant re Molecular Biology. – 1997. – P. 143–158. generation from dinitroaniline–resistant and 3. Vaughn, K. C. Anticytoskeletal herbicides susceptible biotypes of Eleusine indica (L.) / / K. C. Vaughn // Plant Microtubules: Potential A.I. Yemets [et al.] // Plant Cell Rep. – 2003. – for Biotechnology. – 2000. – P. 193–205. V. 21. – P. 503–510.

4. Vaughn, K.C. The abnormal cell plates 16. Sambrook, J. Molecular cloning: A labora formed after microtubule disrupter herbicide treat- tory manual / J. Sambrook, D.W. Russell. – Cold ment are enriched in callose / K.C. Vaughn // Pest. Spring Harbour Press, Cold Spring Harbour, NY, Biochem. Physiol. – 2006. – V. 84. – P. 63–71. 2001. – 999 p.

5. Устойчивость растений к гербицидам 17. Введение в культуру in vitro и регенера с антимикротрубочковым механизмом ционная способность сортов льна–долгунца действия: от природных мутантов до с различной устойчивостью к полеганию / переноса генов / А.И. Емец [и др.] // Физиол. О.А. Баер [и др.] // Физиол. биохим. культ.

6. The biochemistry of compounds with an- 18. Гузенко, Е.В. Трансформация различ timicrotubule activity in plant cells / L.C. More- ных генотипов льна–долгунца с помощью john [et al.] // Pharm. Ther. – 1991. – V. 51. – Agrobacterium tumefaciens: предваритель 7. Structural and functional organization of tu- А.И. Емец, Я.Б. Блюм, Н.А. Картель // Фак bulin / D.E. Fosket [et al.] // Ann. Rev. Plant Physi- торы экспериментальной эволюции ор ol. Plant Mol. Biol. – 1992. – V. 43. – P. 201–240. ганизмов: материалы IV междунар. науч.





8. Drugs with colchicine–like effects that конф., Алушта, 22–26 сентября 2008 г./, specically disassemble plant but not animal mi- К.: Логос;

редкол.: И.Р. Бариляк [и др.]. – crotubules / A.S. Bajer [et al.] // Ann. N.Y. Acad. Алушта, – 2008. – С. 268–273.

9. Structural modelling of plant –tubulin льна–долгунца (Linum usitatissimum L.) / interaction with dinitroanilines and phosphoro- Е.В.Гузенко [и др.] // Докл. Нац. Акад. наук amidates / Ya.B. Blume [et al.] // Cell Biol. Int. Беларуси. Сер. Биол. Наук. – 2009. – Т. 53, 10. Herbicide resistance caused by sponta- 20. Спосiб укорiнення рослин, отриманих в neous mutation of the cytoskeletal protein tu- культурi in vitro: пат. 48060 Украина, МПК bulin / R. Anthony [et al.] // Nature. – 1998. – А 01 Н 4/00/ О.А. Баер, А.И. Емец, Я.Б. Блюм, 11. –Tubulin missense mutations corre- Н.А. Картель;

заявитель Ин–т пищ. биотехн.

late with antimicrotubule drug resistance in и геномики НАН Украины – №u2009 07669;

Eleusine indica / E. Yamamoto [et al.]// Plant заявл. 21.07. 09;

опубл. 10.0.10 // Офиц. бюл.

Cell. – 1998. – V. 10. – P. 297–308. / Нац. Центр Интел. Собственности. – 2010.

12. Distinct tubulin genes are differentially – № 5. – С. 3.

expressed during barley grain development 21. Glyphosate tolerant ax plants from Agro / V.V. Radchuk [et al.] // Physiol. Plant. – bacterium–mediated gene transfer / M. Jordan льна–долгунца мутантным геном тубули- 22. Genetic transformation of ax (Linum на, несущим устойчивость к динитроани- usitatissimum L.) by Agrobacterium tumefa линовым гербицидам / А.И. Емец [и др.] // ciens. Regeneration of transformed shoots via 48 Е.В. Гузенко, В.А. Лемеш. Создание и анализ генетически модифицированных растений льна...

callus phase / N. Basiran [et al.] // Plant Cell Rep. – 1987. – Vol. 6. – P. 396–399.

23. High efciency Agrobacterium–mediated gene transfer to ax / L. Mlynarova [et al.] // Plant Cell Rep. – 1994. – Vol. 13. – P. 282–283.

24. Гузенко, Е.В. Оценка регенерационной способности новых сортов и сортообразцов льна–долгунца (L.ussitatissimum L.) для по следующей агробактериальной трансформа- / В.А. Лемеш [и др] // Вес. Нац. акад. на ции / Е.В. Гузенко, В.А. Лемеш, Л.В. Хоты- вук Беларусі. Сер. біял. навук. – 2010. – лева // Теоретические и прикладные аспекты № 1. – С.18–23.

биохимии и биотехнологии растений: мате- 29. Pinoresinol–lariciresinol reductase gene риалы III Междунар. науч. конф., посвящен. expression and secoisolariciresinol diglucoside 50–летию Отдела биох. и биотехн. раст., accumulation in developing ax (Linum usitatis Минск, 14–16 мая 2008 г./ центр. бот. сад НАН Беларуси;

редкол.: В.Н. Решетников [и др.]. – Минск, – 2008. – Ч. 1. – С. 71–76.

25. Plant cell and biotechnology studies in Linum usitatissimum – a review / S. Millam [et al.] // Plant Cell Tissue Org. Cult. – 2005. – V. 82. – P. 93–103.

26. The use of the phosphomannose isomerase gene as alternative selectable marker for Agro baeterium–mediated transformation of ax (Li num usitatissimum) / F. Lamblin [et al.] // Plant Cell Rep. – 2007. – V. 26. – P. 765–772.

27. Гузенко, Е.В. Получение трансгенных растений льна–долгунца, несущих химерный ген GFP–TUA6 / Е.В. Гузенко, В.А. Лемеш, Г.Я. Баер, О.А. Баер, А.И. Емец, Я.Б. Блюм, Н.А. Картель. // Генетика и биотехнология Молекулярная и прикладная генетика. Том 12, 2011 г.

УДК 604.6:635.

ГЕНЕТИЧЕСКАЯ ТРАНСФОРМАЦИЯ РАСТЕНИЙ ВЕКТОРНЫМИ

КОНСТРУКЦИЯМИ С ГЕНОМ GOX PENICILLIUM FUNICULOSUM

Республика Беларусь, 220072, г. Минск, ул. Академическая, Наряду с методами традиционной селекции, авирулентного патогена. Следует отметить, используемыми для получения высокопродук- что клеточная гибель наступает не вследствие тивных сортов растений, все большее распро- токсического действия активных форм кис странение получают генно-инженерные под- лорода, а как результат запуска сигнальных ходы. Их основным преимуществом являются каскадов [11].

возможности создания растений, обладающих Гиперчувствительный ответ часто сопрово принципиально новыми признаками, которых ждается развитием приобретенной устойчи невозможно добиться с использованием се- вости, специфического состояния растения, лекционных методов. Так, в работах G. Wu с во время которого оно характеризуется значи соавторами (Monsanto Company) было показа- тельным повышением устойчивости к широ но, что трансгенные растения картофеля, экс- кому ряду неродственных патогенов [12, 13].

прессирующие глюкозооксидазу, ген gox, об- Образование и аккумуляция в большом ко ладают повышенной устойчивостью к мокрой личестве пероксида водорода приводит к ряду бактериальной гнили, вызываемой Erwinia физиологических эффектов: клеточной гибели carotovora ssp. Carotovora, вертициллезному при гиперчувствительном ответе;

формирова увяданию, вызываемому Verticillium dahliae и нию системной приобретенной устойчивости;

фитофторозу, вызываемому Phytophtora infes- закрытию устьичных щелей;

образованию tans [1, 2]. Другими авторами были получены окислительных сшивок между белками и дру трансгенные линии риса и капусты с геном гими полимерами растительных клеточных глюкозооксидазы, которые обладали повышен- стенок, а также их лигнификации, в результа ной устойчивостью к некоторым бактериаль- те чего, повышаются их барьерные свойства ным и грибным патогенам [3, 4]. Сообщается, [11, 14]. В то время как для активных форм что экспрессия глюкозооксидазы может при- кислорода в целом, показано ингибирующее водить к запуску защитных механизмов рас- действие на процесс клеточного деления, в тений, таких как образование активных форм случае пероксида водорода – выявлено его кислорода [5, 6], активация защитных генов, стимулирующее влияние на соматический эм локальная клеточная гибель [7] и гиперчув- бриогенез [15].

ствительный ответ [8, 9], и таким образом, по- Пероксид водорода характеризуется и пря вышать защитные свойства растений. мым антимикробным эффектом. Множество Известно, что в результате гиперчувстви- мицелиальных грибов, в первую очередь As тельного ответа происходит быстрая запро- pergillus и Penicillium, секретируют в окружа граммированная гибель клеток в области ющую среду глюкозооксидазу, ингибирующую внедрения патогена, продукция супероксид- развитие других организмов [16]. Возможно аниона и пероксида водорода, образование также участие пероксида водорода и в непо сшивок между полимерами клеточной стен- средственном ингибировании ферментных ки, а также синтез вторичных метаболитов и систем патогенов, участвующих в деградации белков с антимикробной активностью [8, 10]. растительных клеточных стенок [1].

Данные события блокируют распространение Таким образом, можно предположить, что 50 Д.В. Савчин и др. Генетическая трансформация растений векторными конструкциями с геном...

экспрессия гена глюкозооксидазы будет по- цию пероксида водорода и усиления защитных ложительно влиять на процессы развития реакций растений были созданы векторные защитно-приспособительных реакций расте- конструкции с геном глюкозооксидазы Peni ний, способствующих развитию их устойчи- cillium funiculosum и осуществлена агробак вости к разнообразным стрессовым факторам териальная трансформация растений. Среди внешней среды, в том числе и к патогенным полученных линий растений были отобраны С целью изучения влияния экспрессии гена было доказано методом ПЦР и проверкой ак глюкозооксидазы на образование и аккумуля- тивности фермента глюкозооксидазы.

Фермент глюкозооксидаза. Глюкозоок- -D-глюкозы до -D-глюконо--лактона и со сидаза (-D-глюкозо: O2-1-оксидоредуктаза, пряженное восстановление молекулярного КФ 1.1.3.4) катализирует реакцию окисления кислорода до пероксида водорода (рис. 1).

Образующийся -D глюконо--лактон после этого подвергается спонтанному гидролизу до -D глюконата (рис. 2).

Молекулярная масса глюкозооксидазы Кроме -D-глюкозы, данный фермент окис P. funiculosum составляет 140±10 кДа, молеку- ляет также 2-дезокси-D-глюкозу, мальтозу и лярная масса каждой субъединицы – порядка галактозу [18, 19].

70кДа. Фермент обладает высокой субстрат- Трансформация агробактерий. Для про ной специфичностью к -D-глюкозе (Km = ведения экспериментов по агробактериальной 3,3 мМ;

при значении рН 7,0;

25оС). Фермент трансформации табака и картофеля использо характеризуется большей pH- и температур- вали штамм Agrobacterium tumefaciens AGL0.

ной стабильностью, по сравнению с глюкозо- Агробактерии трансформировались методом оксидазой штаммов рода Aspergillus, что, по- замораживания-оттаивания [20]. Клетки бак видимому, указывает на различия в структуре терий культивировали на стандартной агари активных центров этих ферментов [17]. зованной среде LB при температуре 28С. В В качестве источника гена глюкозооксидазы среду добавляли антибиотики рифампицин ( (gox), в данной работе использовали штамм мг/л) для избирательного роста агробактерий 46.1 P. funiculosum. Глюкозооксидаза этого и канамицин (50 мг/л) как селективный мар штамма отличается высокой каталитической кер. Отбор клонов проводился методом ПЦР.

активностью при значении рН выше 6.0. Полученные агробактериальные штаммы с не Молекулярная и прикладная генетика. Том 12, 2011 г.

Д.В. Савчин и др. Генетическая трансформация растений векторными конструкциями с геном...

обходимыми плазмидами использовались для суток при температуре 24-25С, переносили на трансформации растений табака и картофеля. неделю на свет (5000 Лк) на 25С с фотоперио Трансформация растений картофеля. Для дом 16/8 часов, далее помещали чашки с экс трансформации картофеля был выбран сорт плантами в холодильник (+4С) на 12 часов, Скарб. Молодые листья разрезали на несколь- снова переносили на неделю на свет (5000 Лк) ко частей, на которых делали надсечки. Ли- на 25С с фотопериодом 16/8 часов. Регенеран стовые диски выдерживали в суспензии агро- ты срезали по достижении ими длины 1 см и бактерий в течение 15-30 мин. Затем листовые высаживали на среду MS для черенкования с диски отмывали в чашках Петри со стериль- добавлением 200 мг/л тиментина, 1 мг/л НУК, ной Н2О и помещали на чашку с агаризованной 1 мг/л гибберелиновой кислоты и антибиотика MS-LD (соли MS, витамины по Морелю [21], канамицина. После 2-3 пассажей переносили сахароза 30 г/л, цитокинины: 2,5 мг/л БАП на стандартную среду MS.

(6-бензиламинопурин), 1 мг/л зеатин, аукси- Трансформация растений табака. Для ны: 0,1 мг/л НУК (нафтилуксусная кислота), трансформации табака использовали линию агар 7 г/л рН 5,8) в количестве 15-20 дисков N.tabacсum cv. Petit Havana SR. Молодые ли на чашку. Чашки инкубировали в темноте при стья табака нарезали на небольшие фрагменты температуре 24С до появления светлого агро- и помещали в чашку с разбавленной суспен бактериального ореола. Затем экспланты пере- зией агробактерий. Чашки заворачивали в па носили на среду MSR2 (соли MS, витамины рафильм и 2-3 суток выдерживали в темноте по Морелю [21], сахароза 30 г/л, 1 мг/л БАП при 22C. Затем экспланты извлекали из жид (6-бензиламинопурин), 2 мг/л зеатин, 0,1 мг/л кой среды и помещали на агаризованную среду НУК (нафтилуксусная кислота), 0,5 мг/л кине- CIM (соли и витамины MS, 30 г/л сахарозы, тин, 0,1 мг/л гибберелиновая кислота, агар 7 0,2 мг/л БАП, 1 мг/л НУК, рН 5,8) с добавле г/л рН 5,8) с добавлением антибиотика тимен- нием 50 мг/л канамицина и 200 мг/л тимен тина (тикарциллин+клавулановая кислота) в тина. Через 2 недели проводили пересадку на концентрации 200 мг/л и селективного агента агаризованную среду SIM (соли и витамины (канамицина в концентрации 50 мг/л). Через MS, 30 г/л сахарозы, 8 г/л агара, 1 мг/л БАП, 5 дней пересаживали экспланты на свежую 0,1 мг/л НУК, 50 мг/л канамицина, 200 мг/л среду с антибиотиками того же состава. Далее тиментина, рН 5,8). Регенеранты отсаживали экспланты пересаживали, удаляя некрозы, с на агаризованную среду RIM (соли и витами Для повышения эффективности каллусоге- ИУК, 50 мг/л канамицина, 200 мг/л тименти неза использовали контрастную стимуляцию: на, рН 5,8). После 2-3 пассажей регенеранты помещали чашки с эксплантами в темноту на 2 переносили на стандартную среду MS.

Создание векторных конструкций с ге- Pfu ДНК-полимеразой. В полученный вектор ном глюкозооксидазы. Ген gox был выде- клонирован фрагмент, содержащий ген gox. В лен из грибного штамма 46.1 P. funiculosum результате получена плазмида, которая несет в и клонирован в плазмиду pUC18 по сайтам одной рамке считывания лидерную последова NdeI и EcoRI. Полученная плазмида была об- тельность секреции в апопласт и ген глюкозо работана ферментами NdeI и затем Pfu ДНК- оксидазы P. funiculosum. Это позволяет белку полимеразой для образования тупых концов. секретироваться в апопласт и, таким образом, Затем плазмида была рестрицирована по сай- защищает клетку от возможных неблагоприят ту EcoRI. Плазмида pGem5Zf(+), несущая по ных эффектов, связанных с внутриклеточной сайту PstI вставку гена лихеназы с лидерной экспрессией глюкозооксидазы.

последовательностью экстенсина моркови под В дальнейшем полученная кассета, состоя контролем CaMV 35S промотора, была обра- щая из лидерного пептида и гена глюкозоок ботана рестриктазами HindIII и EcoRI. Сайт сидазы, была переклонирована в плазмиду узнавания рестриктазы HindIII был затуплен pND706 по сайтам SalI и EcoRI. Из этой плаз 52 Д.В. Савчин и др. Генетическая трансформация растений векторными конструкциями с геном...

миды вставка была вырезана рестриктазой сайтам SmaI и Ecl136II. Полученный вектор SmaI и клонирована в плазмиду pBI121 по назван pBI-L-GOX (рис. 3).

Рис. 3. Схема растительного вектора pBI121 с геном глюкозооксидазы, pBI-L-GOX.

Так же был создан вектор с промотором tII KS (+) по сайтам EcoRV и EcoRI. Затем CaMV 35S, энхансером омега и геном gox. фрагмент полученной плазмиды, содержа Это должно привести к увеличению уровня щий промотор, был переклонирован в плаз транскрипции гена, и таким образом, увели- миду pBIlin по сайтам HindIII и SmaI. По чить количество фермента глюкозооксидазы. сайту StuI клонирована кассета nos-nptII. В Из плазмиды pCd промотор CaMV 35S с эн- полученный вектор клонирован ген gox по хансером омега был вырезан по сайтам SmaI сайтам SmaI и Ecl136II. Полученный вектор и EcoRI и клонирован в плазмиду pBluescrip- назван pBI-F-GOX (рис. 4).

Рис. 4. Схема растительного вектора pBI121 с геном глюкозооксидазы, pBI-F-GOX.

Полученные векторы были использованы Молекулярный анализ полученных рас для проведения агробактериальной трансфор- тений. С целью обнаружения вставки целе мации растений табака и картофеля. вого фрагмента, гена глюкозооксидазы, была Трансформация растений. В ходе проведе- использована следующая пара праймеров:

ния агробактериальной трансформации расте- 5'-TGAAATTGGCGAAGAAGACGGC -3' и ний картофеля сорта Скарб, было получено, 5'- TGGAATTGGGACAACATGTTCGAGT 120 регенерантов с векторной конструкцией -3', генерирующих фрагмент длиной pBI-L-GOX и 80 регенерантов с векторной п.н.. Реакцию ПЦР проводили в буфере для конструкцией pBI-F-GOX, укоренившихся Taq-полимеразы, с добавлением 0.02 мMоль на среде с канамицином. В эксперименте по каждого из dNTP, 0.2 мкМоль каждого из трансформации табака было отобрано по 10 праймеров, 150-200 нг ДНК картофеля либо регенерантов с каждым растительным векто- табака и 1-2U Taq-полимеразы. Амплифи ром. Первичные трансформанты, проявившие кация проводилась по следующей програм способность образовывать корневую систему в ме: 94°С – 5 мин, 30 циклов [94°С – 30 сек, присутствии канамицина, были отобраны для 54°С – 30 сек, 72°С – 45 сек], 72°С – 7 минут.

дальнейших исследований. Из данных расте- Продукты амплификации разделялись в 1,5% ний была выделена ДНК для проведения ПЦР. агарозном геле (рис. 5).

Молекулярная и прикладная генетика. Том 12, 2011 г.

Д.В. Савчин и др. Генетическая трансформация растений векторными конструкциями с геном...

Рис. 5. Электрофоретическое разделение продуктов амплификации ДНК растений картофеля, отобранных на канамицине. М – маркер молекулярного веса, 1-15 – образцы растений, проявляющих устойчивость к канами цину, 16 – положительный контроль, плазмида с геном глюкозооксидазы. Присутствие продукта амплифика ции свидетельствует о наличии встроенного гена gox в геном растения.

Так же были подобраны пары праймеров для который экспрессируется во всех растениях определения наличия последовательности nos- картофеля, и может быть использован как по терминатора, фрагмент 180 п.н. и контрольного ложительный контроль для проверки качества резидентного гена актина, фрагмент 550 п.н., выделенной ДНК и проведения ПЦР (рис. 6).

Рис. 6. Электрофоретическое разделение продуктов амплификации ДНК трансгенных и контрольных расте ний картофеля. М – маркер молекулярного веса, 1-6 – образцы трансгенных растений, 7-8 – образцы нетранс формированных растений картофеля, 9 – положительный контроль, 10 – отрицательный контроль. Верхний фрагмент, 550 п.н. – ген актин. Нижний фрагмент, 180 п.н. nos-терминатор.

Присутствие рекомбинантных агробакте- отобранных первичных трансформантов таба риальных штаммов, потенциально являю- ка и картофеля.

щихся источником ложно-положительных Таким образом, в результате молекулярно результатов при ПЦР-анализе трансформан- генетического анализа, были отобраны рас тов, проверяли методом ПЦР с праймерами тения, которые несут в своем геноме вставку и 5’-TTTCGAGTCATGCATAATGCCTGAC-3’, Проверка активности фермента глюко специфичными к агробактериальному гену зооксидазы чашечным тестом. Для дока VirE2, по следующей программе: 95С – 5 зательства того, что в растениях табака и мин, 30 циклов [94С – 30 сек, 60С – 30 сек, картофеля эффективно синтезируется ре 72С – 42 сек], 72С – 7 мин. Продукты ампли- комбинантный белок, был проведен следу фикации разделялись в 1,5% агарозном геле. ющий эксперимент: листья, части корней Отсутствие ПЦР-продукта свидетельствует об и стеблей предположительно трансгенных отсутствии агробактерий в проводящих путях растений помещали на 1%–ный агарозный растений и, соответственно, подтверждают до- гель, содержащий 50 мМ йодида калия, 5% стоверность результатов, свидетельствующих крахмала, 200 мМ D-глюкозы. В результате о наличии целевых генов в геномном составе чего, глюкозооксидаза окисляла глюкозу и 54 Д.В. Савчин и др. Генетическая трансформация растений векторными конструкциями с геном...

образовывался пероксид водорода. Образо- тельных тканей [15]. Вокруг контрольных вание пероксида водорода регистрировали растений окрашивания не происходило по развитию синей окраски вокруг расти- (рис. 7).

Рис. 7. Определение активности гена глюкозооксидазы. L и F – линии трансгенных растений, Полученные результаты в ходе проведения тений табака было отобрано по 3 регенеранта с ПЦР и чашечного теста свидетельствуют о на- каждой векторной конструкцией.

личии и экспрессии гена глюкозооксидазы в Все растения, которые давали окрашивание полученных трансгенных растениях. при проведении чашечного теста, являлись В результате проведенных экспериментов бы- положительными при проведении амплифи ло отобрано 53 растения картофеля, трансфор- кации с праймерами к гену gox, что может мированных вектором pBI-L-GOX и 24 расте- свидетельствовать о высокой эффективности ния картофеля, трансформированных вектором данного подхода при отборе трансформантов и pBI-F-GOX, что составляет 44% и 30% среди исключить растения, в которых имеется встав отобранных на канамицине растений. Среди рас- ка целевого гена, но экспрессия не происходит.

Таким образом, в результате выполненной Активность глюкозооксидазы выявлена в рас работы были созданы векторы для трансфор- тениях по способности генерировать большое мации растений с геном глюкозооксидазы gox количество перекиси водорода в присутствии P. funiculosum. В результате агробактериаль- глюкозы. Можно ожидать, что экспрессия глю ной трансформации табака и картофеля гене- козооксидазы приведет к повышению устойчи тическими конструкциями получены линии вости растений к неблагоприятным факторам трансгенных растений, в которых при помощи и широкому ряду патогенов, что будет прове ПЦР обнаруживается вставка данного гена. рено последующими экспериментами.

1. Disease Resistance Conferred by Expres- 1997. – Vol. 115. – P. 427–435.

sion of a Gene Encoding H2O2–Generating Glu- 3. Induction of H2O2 in transgenic rice leads cose Oxidase in Transgenic Potato Plants / Gusui to cell death and enhanced resistance to both Wu [et al.] // The Plant Cell. – 1995. – Vol. 7. – bacterial and fungal pathogens / A. Kachroo [et 2. Activation of Host Defense Mechanisms P. 577–586.

by Elevated Production of H2O2 in Transgenic 4. Enhanced disease resistance in transgen Plants / Gusui Wu [et al.] // Plant Physiology. – ic cabbage and tobacco expressing a glucose Молекулярная и прикладная генетика. Том 12, 2011 г.

Д.В. Савчин и др. Генетическая трансформация растений векторными конструкциями с геном...

oxidase gene from Aspergillus niger / Y.H. Lee defence response in Lycopersicon esculentum [et al.] // Plant Cell Rep. – 2002. – Vol. 20. – – L / I. H. Attitalla // Acta Universitatis Upsa 5. Elicitor– and wound– induced oxidative 14. The involvement of hydrogen peroxide cross–linking of a praline–rich plant cell wall pro- in the differentiation of secondary walls in tein: A novel, rapid defense response / D.J. Brad- cotton bers / T. S. Potikha [et al.]. // Plant ley [et al.] // Cell. – 1992. – Vol. 70. – P. 21–30. Physiology. – 1999. – Vol. 119. – P. 849–858.

6. Activation, structure and organization of 15. Signal transduction during oxidative stress / genes involved in microbial defenses in plants E. Vranova [et al.] // J. of Exp. Botany. – 2002. – / R.A. Dixon [et al.] // Adv. Genet. – 1990. – Vol. 53. – P. 1227–1236.

7. Keen, N.T. The molecular biology of dis- Talaromyces avus and characterisation of its role ease resistance / N.T. Keen // Mol. Biol. – 1992. – in the biocontrol of Verticillium dahliae / F.R. Mur 8. Greenberg, J.T. Programmed cell death P. 367–375.

in plant–pathogen interactions / J.T. Greenberg 17. Cтабильность и каталитические свой– // Annu. Rev. Plant Physiol. Plant Mol. Biol. – ства глюкозооксидазы из Penicillium 9. The role and regulation of programmed Вестник Московского Университета. – 2002.

cell death in plant–pathogen interactions / J.T. – Т. 43. – С. 366–370.

Greenberg [et al.] // Cellular Microbiology. – 18. Внеклеточная глюкозооксидаза Penicil 10. Resistance gene–dependent plant defense // Прикладная биохимия и микробиология. – responses / K.E. Hammond–Kosack [et al.] // 2003.– Т. 39. – С. 419–426.

Plant Cell. – 1996. – Vol. 8. – P. 1773–1791. 19. Glucose oxidase from Aspergillus niger / 11. Defense activation and enhanced pathogen K. R. Frederic [et al.] // The Journal of Biological tolerance induced by H2O2 in transgenic tobacco / Chemistry. – 1990. – Vol. 265. – P. 3793–3802.

S. Chamnongpol [et al.] // Plant Biology. – 1998. – Vol. 95. – P. 5818–5823.

12. Gozzo, F. Systemic acquired resistance in crop protection / F. Gozzo //Outlooks on Pest Management. – 2004. – P. 20–23.

13. Attitalla, I. H. Biological and molecular [et al.] // Physiol. Plant. – 1962. – Vol. 15. – characteristics of microorganism–stimulated P. 473–497.

УДК 634.11:631.524. О.Ю. Урбанович1, З.А. Козловская2, В.В. Васеха2, П.В. Кузмицкая1, Н.А. Картель

ИДЕНТИФИКАЦИЯ ГЕНА VA1 СРЕДИ СОРТОВ И ОБРАЗЦОВ ЯБЛОНИ

РАЗЛИЧНОГО ПРОИСХОЖДЕНИЯ, ВЫРАЩИВАЕМЫХ В БЕЛАРУСИ

РУП «Институт плодоводства» Республика Беларусь, 223013, Минская обл.

В условиях Республики Беларусь одним из яблони. Так, сеянец яблони, известный под самых вредоносных и широко распростра- названием Russian seedling R12740-7A, яв ненных заболеваний яблони является парша, ляется источником двух генов Rvi2 (Vh2) и которая поражает листья, плоды, цветки, мо- Rvi4 (Vh4) [4]. Ген Rvi5(Vm) присутствует у лодые побеги и почечные чешуйки. Возбу- клонов диких видов M.micromalus 245- дителем заболевания является гриб Venturia и M.atrosanguinea 804 [5]. Получивший inaequalis (Coock.) Wint. (конидиальная ста- самое большое распространение в совре дия Fusicladium dendriticum (Wallr.) Fuck.). У менных сортах яблони ген Rvi6(Vf) впер восприимчивых сортов в годы эпифитотий- вые был обнаружен у дикого вида яблони ного развития заболевания снижение выхода с мелкими плодами M.oribunda 821 [6].

первосортной продукции может достигать В геноме M.floribunda 821 позже был 90% [1]. Выделение высокоустойчивых и обнаружен второй ген Rvi7 (Vfh) [7]. Ген устойчивых сортов и их внедрение в про- Rvi8 (Vh8) был идентифицирован в геноме мышленное садоводство является безопас- M. sieversii W193B [8]. Гены Rvi11(Vbj) ным методом защиты яблони и эффективным и Rvi12(Vb) найдены у M. baccata jackii и способом получения продукции с улучшен- Hansen’s baccata #2 [9]. Источником гена ными экологическими характеристиками, Rvi15 (Vr2) является образец дикой яблони что, впоследствии, будет способствовать GMAL 2473 Rvi15 (Vr2) [10]. Интродукция уменьшению техногенной нагрузки на са- генов устойчивости к парше из диких видов В настоящее время известно не менее 15 эффективной, как показывает практическое генов, обеспечивающих устойчивость ябло- использование гена Rvi6(Vf). Как правило, ни к парше [2]. Традиционно используемые этому предшествует длительный селекци названия этих генов были даны авторами, онный процесс, необходимый для того, что впервые описавшими конкретный ген. В. бы избавится от нежелательного влияния, Бас с соавторами предложили новую номен- которые дикие виды яблони оказывают на клатуру генов устойчивости к парше, соот- качество плодов.

ветствующую современным международ- Среди культурных сортов известными ным требованиям [2, 3]. Пока в литературе источниками генов устойчивости к парше наряду с новым названием, в скобках при- являются Golden Delicious (ген Rvi1 (Vg)), водится и традиционное название гена [2]. старый итальянский сорт Durello di Forli В данной статье мы будем придерживаться (Rvi13(Vd)), немецкий сорт Dlmener Rose Известные гены устойчивости к парше коэффективным источником устойчивости к различаются по происхождению. Источ- парше признан старый русский сорт Анто ники генов были обнаружены как среди новка обыкновенная, происхождение кото культурных сортов, так и у диких видов рого неизвестно. Считается, что этот сорт Молекулярная и прикладная генетика. Том 12, 2011 г.

О.Ю. Урбанович и др. Идентификация гена VA1 среди сортов и образцов яблони... обладает как полигенной, так и моногенной ризуются также многие сорта белорусской устойчивостью [14]. В геноме разных об- селекции, целенаправленная работа по соз разцов Антоновки выявлены гены Rvi10(Va), данию которых была начата в 20-х годах XX Rvi17(Va1) и Va2 [15, 16]. Природа полиген- ст. В частности, сорта яблони, созданные ной устойчивости окончательно не выясне- А.Е. Сюбаровым с использованием высо на. Однако бесспорно, что сорт демонстри- ко устойчивых к парше исходных форм, со рует высокую устойчивость к парше, и что храняют свою актуальность в селекции и особенно важно, в полевых условиях, на сегодня [19]. К сожалению, пока не удалось протяжении длительного времени возделы- выявить генетический механизм, обуслав вания. Благодаря этим качествам он широко ливающий высокую полевую устойчивость используется как источник устойчивости к этих сортов к заболеванию.

парше во многих селекционных програм- Данное исследование было проведено с мах [17, 18]. Ряд современных сортов, вклю- целью выявления источников одного из ге ченных в Государственный реестр сортов и нов, который несет Антоновка обыкновен древесно-кустарниковых пород Республики ная, гена Rvi17(Va1), среди сортов яблони Беларусь, являются потомками Антоновки различного генетического происхождения, Кроме этого сорта, высокой устойчиво- с данным геном для дальнейшей селекци стью к парше в полевых условиях характе- онной работы.

Объекты исследования. Объектом изу- зультате ПЦР. Название, последовательность чения служили 128 сортов и видов яблони, и температура отжига праймеров представ произрастающих в саду РУП «Институт пло- лена в таблице 1. Праймеры синтезированы доводства». Сформированная выборка была компанией Праймтех (Беларусь).

представлена сортами различного генети- Реакционная смесь для ПЦР объемом ческого происхождения селекции Беларуси, мкл содержала 40 нг ДНК, 75 мМ трис-HCl России, Украины, Германии, США и других (pH 8.8 при 25°С), 20 мМ (NH4)2SO4, 0,01% стран. В исследование были включены как со- Tween 20, 0,2 мМ dNTP, 200 мМ каждого временные сорта, так и старые сорта, традици- праймера, 1 ед. Taq-полимеразы. Реакцию онно выращиваемые в Беларуси. Для каждого проводили в следующем режиме: 94°С – сорта уточнялась родословная. Анализу под- мин;

40 циклов 94°С – 40 сек, Т°отж – 1 мин, вергались также гибридные сеянцы яблони, 72°С – 2 мин;

72°С – 8 мин.

полученные от различных комбинаций скре- Продукты амплификации с праймерами щивания в РУП «Институт плодоводства». Vf2ARD обрабатывали рестриктазой FokI Выделение ДНК. Препараты ДНК были (Fermentas) в течение 2 часов при 55°С в получены из фрагмента листа отдельного буфере, рекомендуемом фирмой Fermentas.

растения. Выделение ДНК проводили с по- Продукты амплификации разделяли в 1% мощью Genomic DNA Purication Kit фир- агарозном геле в трис-ацетатном буфере.

мы Fermentas согласно рекомендованному Гели документировали с помощью фото Условия амплификации. Для идентифи- бромидом. В качестве маркера молекуляр кации генов Rvi6(Vf) и Rvi17(Va1) применяли ного веса использовали 100 bp DNA Ladder молекулярные маркеры, выявляемые в ре- Plus (Fermentas).

О.Ю. Урбанович и др. Идентификация гена VA1 среди сортов и образцов яблони...

Название, последовательность и температура отжига праймеров, использованных для

F GGT TTC CAA AGT CCA ATT CC

R CGT TAG CAT TTT GAG TTG AC

F TGG AAG AGA GAT CCA GAA AGT G

RCAT CCC TCC ACA AAT GCC

F CGT AGA ACG GAA TTT GAC AGT G

R GAC AAA GGG CTT AAG TGC TCC

F TCT TGG ACC TAA GCA ACA ATG AT

R AGT TGT CCT GTA AGT TGA TTG GC

Для идентификации гена Va1 был исполь- Антоновку. Он был получен в результате сле зован молекулярный маркер Vf2ARD [16]. дующей комбинации скрещивания: (Macoun Маркер ограничивает последовательность Antonovka) (Golden Delicious F2 26829-2-2).

VfARD, расположенную на расстоянии 3.1 Проведенные ранее исследования указывали сМ от гена. На основе первичной последова- на то, что Freedom унаследовал ген устойчиво тельности этого фрагмента разработан CAPS сти к парше от Антоновки [22]. Предположе маркер, позволяющий идентифицировать ген ние было основано на результатах наблюдения Rvi17(Va1) [16]. О присутствии гена свидетель- в полевых условиях за потомством Freedom.

ствует фрагмент длиной 343 п.н., выявляемый Полученные нами результаты говорят в пользу после разрезания продуктов амплификации того, что сорт содержит ген Rvi17(Va1).

рестриктазой FokI. Маркерный фрагмент был Под названием Антоновка в разных коллек обнаружен у 12 сортов. Результаты представ- циях мира, в частности в Geneva apple ger Сорта белорусской селекции Белорусский генотипы [14]. Генетические отличия между синап, Чаравница, содержащие маркерный отдельными образцами были подтверждены фрагмент гена Rvi17(Va1), являются непо- [23]. Изменчивость Антоновки отмечена от средственными потомками сорта Антоновка ечественными помологами [24, 25]. В пред обыкновенная. Родителем сорта Пепин ли- ставленном исследовании мы провели тести товский улучшенный вероятно также является рование 10 образцов Антоновки, собранных в Антоновка обыкновенная, на что указывают разных частях Беларуси и имеющих отличия многочисленные морфологические призна- по морфологическим признакам. Результаты ки. Сорта Коваленковское, Лошицкое, Память представлены на рисунке 1. Они показали, Пашкевича, Коробовка крупноплодная были что из 10 образцов 9 содержат маркерный получены в результате свободного опыления, фрагмент, соответствующий гену Rvi17(Va1).

что затрудняет поиск вероятного родителя и У образца под номером 19 данный фрагмент источника гена. Вербное и Новинка осени не представлен. Очевидно, что этот образец не являются прямыми потомками Антоновки, отличается от других на генетическом уров но, возможно, что у их исходных форм имелся не. Соответствующий гену фрагмент пред общий предок с Антоновкой. Сорт Freedom ставлен в геноме Антоновки стаканчатой селекции США также имеет в родословной могилевской.

Молекулярная и прикладная генетика. Том 12, 2011 г.

Результаты тестирования сортов, видов и образцов яблони на присутствие гена Образцы, содержащие маркерный фрагмент Образцы, не содержащие маркерный фрагмент гена Rvi17(Va1) гена Rvi17(Va1) Банановое, Белорусское летнее, Белорусское малиновое, Белорусское сладкое, Белый налив, Болотовское, Боровинка, Важак, Веньяминовское, Весялина, Ветеран, Witos, Дарунак, Jonagold, Discovery, Dolgo, Edera, Елена, Geneva, Антоновка обыкновенная, Антоновка стаканчатая Минское, Надзейны, Народное, Несравненное, Новое сладкое, Нора, Орловим, могилевская, Белорусский синап, Вербнае, Коваленковское, Коробовка крупноплодная, Лошицкое, Новинка осени, Память Пашкевича, Пепин Старт, Стойкое, Строевсое, Сябрына, Теллисааре, Topaz, Утро, Wealthy, Fiesta, литовский улучшенный, Florina, Цыганочка, Черное дерево, Чистотел, Чулановка, Щедрое, Elstar, Em Freedom, Чаравница.

У ряда сортов, родословная которых не- ных сеянцев. Сорт Чаравница был получен в посредственно связана с сортом Антоновка результате скрещивания сортов Белорусский обыкновенная: Алеся, Антей, Белорусское синап и Ренет Кокса (Cox’s Orange Pippin) в малиновое, Заславское, Имант, Имрус, Над- 1963 г. Е.В. Семашко. Он обладает рядом хо зейны, Орловим, Память Коваленко, Память зяйственно ценных качеств, среди которых Сюбаровой, Первинка, Поспех, Свежесть, Чи- устойчивость к парше, мучнистой росе, тле, стотел – искомый ген выявлен не был. Тем не зимостойкость. К его преимуществам по срав менее, для представленных сортов характерна нению с Антоновкой обыкновенной можно полевая устойчивость к парше, что позволяет отнести более высокое качество плодов и про рассматривать сорт Антоновка обыкновенная должительный срок хранения.

и его потомков как объект для дальнейших С использованием сорта Чаравница было по более углубленных исследований природы лучено нескольких гибридных семей. Сеянцы, Сорта, несущие маркерный фрагмент гена подвергнуты анализу на присутствие маркера Rvi17(Va1) характеризуются высокой устой- к гену Rvi17(Va1). Тестирование показало, что чивостью к парше. Один из этих сортов, маркерный фрагмент унаследовало 62 сеянца Чаравница, был использован в качестве ма- из 157, что составляет 39,5% от общего числа теринского растения при получении гибрид- образцов (табл. 3).

О.Ю. Урбанович и др. Идентификация гена VA1 среди сортов и образцов яблони...

Рис. 1. Результаты разделения методом электрофореза в 1% агарозном геле продуктов амплификации ДНК образцов яблони с маркером Vf2ARD. М -маркер молекулярного веса GeneRulertm 100bp DNA Ladder Plus (Fer mentas);

1 - Алеся, 2 - Alkmene, 3 - Антей, 4 - Антоновка стаканчатая могилевская, 5 - Ауксис, 6 - Бабушкино, 7 - Банановое, 8 - Белорусский синап, 9 - Белорусское летнее, 10-19 - образцы Антоновки обыкновенной.

Кроме того, в геноме отдельных гибридных 1-2 балла) – 76%. Также среди данной группы сеянцев представлен высокоэффективный ген 18% растений были отнесены к среднепоража устойчивости к парше Rvi6(Vf). Присутствие емым (поражение 3 балла), а 6% не имели при гена было подтверждено тестированием с по- знаков поражения. Среди сеянцев, у которых мощью молекулярных маркеров VfC и AL07 были выявлены оба гена Rvi17(Va1) и Rvi6(Vf), + AM19. При этом маркер VfC ограничивает 8% генотипов проявили исключительно вы фрагмент гомологов генов устойчивости, один сокую стабильную полевую устойчивость из которых соответствует гену Rvi6(Vf), что к заболеванию (поражение отсутствовало), позволяет с максимальной точностью опреде- 76% анализируемых растений оказались лять присутствие гена. Маркер AL07 + AM19 устойчивыми к парше – поражение не более является сцепленным. Результаты, полученные 1 балла, лишь на 8% сеянцев развитие пато с использованием обоих маркеров, полностью гена V. inaequalis достигало 2 баллов. Доля совпали. Ген Rvi6(Vf) был обнаружен в гено- среднепоражаемых сеянцев составила толь ме 34 гибридных сеянцев. Он представлен в ко 8%, а восприимчивых к парше генотипов образцах из гибридных семей, полученных от выявлено не было. Данные гибриды пред комбинации скрещивания Чаравница Имрус, ставляют собой ценные исходные формы Чаравница Сябрына. Источником гена явля- для дальнейшей селекционной работы, осо лись сорт Имрус и сорт белорусской селекции бенно с учетом того, что в эпифитотийные Сябрына, полученных в результате скрещива- годы поражение сортов Имрус и Сябрына, ния Lobo Prima. Два сеянца с геном Rvi6(Vf) используемые в качестве источников гена были обнаружены в гибридной семье Чарав- Rvi6(Vf), достигало 2 баллов.

ница св. оп. В данном случае произошло опы- Важно, что оба гена являются высокоэффек ление неизвестным источником гена. тивными. Ген Rvi6(Vf) обеспечивает устойчи Среди гибридных сеянцев выявлено 13, вость к нескольким расам патогена. Считает содержащих одновременно ген Rvi6(Vf) и ся, что на эффективность этого гена влияют Rvi17(Va1), что составляет 8,3% от общего гены-модификаторы, которые содержат разные количества сеянцев. Наибольшее количество сорта яблони [26]. В последнее время от таких образцов (9) представлено в семье Ча- мечены случаи преодоления устойчивости, Полевая оценка анализируемых сеянцев по- на. Поэтому особую актуальность приобрел казала, что среди гибридов, содержащих толь- поиск новых источников генов устойчиво ко ген Rvi17(Va1), абсолютное большинство сти к парше. Одним из таких генов может оказалось устойчивыми (поражение паршой стать Rvi17(Va1). Спектр устойчивости гена Молекулярная и прикладная генетика. Том 12, 2011 г.

Rvi17(Va1) к различным расам V. inaequalis до стоять расам 6 и 7 [16]. Объединение в одном конца не известен. Однако имеющиеся сведе- генотипе генов Rvi6(Vf) и Rvi17(Va1) обеспе ния демонстрируют, что он способен противо- чивает эффективную защиту яблони от парши.

Результаты тестирования гибридных сеянцев яблони (Белорусское малиновое + Чаравница) св. оп.

В целом, распределение среди коллек- лирует с устойчивыми генотипами [29]. Для ционных образцов яблони сцепленного с идентификации гена Rvi4 (Vh4/Vr1) позже геном фрагмента амплификации, выявляе- был разработан сцепленных маркер AD мого с помощью маркера Vf2ARD, говорит SCAR [29]. Данных о его эффективности о том, что данный маркер может обладать пока не приводилось.

достаточно высокой диагностической цен- Бесспорными диагностическими преиму ностью. Соответствующие гену фрагменты ществами обладают молекулярные маркеры, выявляются в геноме сортов, связанных ограничивающие непосредственно после с Антоновкой общим происхождением, а довательность тестируемых генов, напри также у генетически близких сортов. Мар- мер маркер VfC для идентификации гена кер не детектируется у диких видов и вос- Rvi6(Vf). Однако количество таких маркеров Не всегда молекулярные маркеры, разра- хозяйственно ценными генами. Сцепленные ботанные с помощью анализа популяции, маркеры могут обеспечивать получение до полученной от скрещивания контрастных статочно точных результатов. В частности, по данному маркеру родителей, могут быть результаты, полученные в представленном применимы при анализе больших выборок исследовании при использовании маркера сортов различного генетического проис- VfC к гену и сцепленного с ним маркера хождения [27]. В ряде случаев сцепленный AL07 + AM19, были полностью идентичны.

с геном маркерный фрагмент может наблю- Поэтому при использовании сцепленных даться в геноме образцов, данный ген не со- маркеров необходимо опираться на знание держащих. Так, например, для идентифика- их диагностической ценности. Молекуляр ции гена Rvi4 (Vh4) был предложен маркер ные маркеры, тесно сцепленные с генами, OPB18 [28]. Однако при анализе популяции потенциально обеспечивают получение бо Regina Piora было обнаружено, что мар- лее надежных результатов [14, 30]. Вместе с керный фрагмент длиной 620 п.н. не корре- тем, молекулярные маркеры, которые могут О.Ю. Урбанович и др. Идентификация гена VA1 среди сортов и образцов яблони...

дать ошибочные результаты при тестиро- могут быть полезны при анализе потом вании обширных коллекций, представлен- ства, полученного от контрастных по этому ных генетически разнородным материалом, маркеру родителей.

В результате проведенного исследования бы- на основе сорта Чаравница, содержащие гены ли выявлены сорта яблони, содержащие в со- устойчивости к парше Rvi6(Vf) и Rvi17(Va1).

ставе генома ген Rvi17(Va1). Среди них потомки Они отличаются высокой полевой устойчиво сорта Антоновка и сорта, полученные в резуль- стью к парше в эпифитотийные годы. Таким тате свободного опыления. Отмечена высокая образом, объединение в одном генотипе двух диагностическая ценность маркера Vf2ARD. высокоэффективных генов обеспечивает ста Выявлены гибридные сеянцы, полученные бильно высокую устойчивость сеянцев к парше.

1. Биоэкологические особенности и кон- the wild apple Malus sieversii is closely linked троль развития гриба Venturia inaequalis to the Vh2 locus in Malus pumila R12740–7A Coocke Winter в яблоневых садах интен сивного типа: автореф. дис. … канд. биол. Vol. 166. – P. 1035–1049.

наук: 06.01.11 / В.С. Комардина // РНДУП 9. Independent genes in Malus for resis «Институт защиты растений». – Прилуки. – 2. Towards improvement of marker assisted Vol. 92. – P. 89–94.

selection of apple scab resistant cultivars: Ven turia inaequalis virulence surveys and standard- A. Patocchi [et al.] // Theor Appl Genet. – ization of molecular marker alleles associated 2004. – Vol. 109. – P. 1087–1092.

with resistance genes / A. Patocchi [et al.] // Mol 11. Characterisation and genetic mapping of Breed. – 2009. – Vol. 24, № 4. – P. 337–347. a major scab resistance gene from the old Ital 3. A proposal for the nomenclature of Ventu ria inaequalis races / V. Bus [et al.] // Acta Hor- [et al.] // Acta Hortic. – 2004. – Vol. 663. – 4. The Vh2 and Vh4 scab resistance genes in 12. Inheritance of Malus oribunda clone two differential hosts derived from Russian ap ple R12740–7A map to the same linkage group L. Parisi, F. Laurens // IOBC/WPRS Bull. – of apple / V.G.M. Bus [et al.] // Mol Breed. – 1997. – Vol. 20. – P. 1–7.

5. Additional allelic genes in Malus for scab and identication of Rvi14, a new major gene resistance of two reaction types / D.F. Dayton, that acts together with other broad–spectrum E.B. Williams // J Am Soc Hort Sci. – 1970. – 6. Apple scab resistance from R12740– 7A, a Russian apple / D.F. Dayton, J.R. Shay, C. Gessler [et al.] // Crit Rev in Plant Sc. – 2006.

L.F. Hough // Proc Am Soc Hort Sci. – 1953. – – Vol. 25. – P. 473–503.

7. Genetics of host–pathogen relationship be tween to Venturia inaequalis races 6 and 7 Malus Angers Fruit Breed Symp. – 1970.

species / G. Bnaouf, L. Parisi // Phytopathol- 16. A major resistance gene from Russian ogy. – 2000. – Vol. 90. – P. 236–242. apple ‘Antonovka’ conferring eld immunity 8. The Vh8 locus of a new gene–for–gene against apple scab is closely linked to the Vf lo interaction between Venturia inaequalis and Молекулярная и прикладная генетика. Том 12, 2011 г.

Genom. – 2010. – Vol. 6, № 5. – P. 627–633. ни / Под ред. А.Н. Ипатьева. – 1972. – P. 240.



Pages:     | 1 | 2 || 4 | 5 |   ...   | 8 |
 
Похожие материалы:

«МОРДОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ИСТОРИКО-СОЦИОЛОГИЧЕСКИЙ ИНСТИТУТ КАФЕДРА ЭКОНОМИЧЕСКОЙ ИСТОРИИ И ИНФОРМАЦИОННЫХ ТЕХНОЛОГИЙ КРЕСТЬЯНИН В МИРУ И НА ВОЙНЕ Сборни материалов III Мер ш инс их на чных чтений Саранс Типо рафия Красный О тябрь 2005 УДК 316.3 ББК Т3(2Рос-Мор) К–271 Ответственный редактор – Н. М. Арсентьев Редакционная коллегия: В. М. Арсентьев, Э. Д. Богатырев, О. И. Марискин, К. И. Шапкарин, В. В. Щербаков Издание осуществлено за счет средств республиканского бюджета Республики ...»

«Океаны энергии 1 Augusta Goldin OCEANS OF ENERGY Reservoir of Power for the Future Harcourt Brace Jovanovich / New York and London Аугуста Голдин ОКЕАНЫ ЭНЕРГИИ Источники энергии будущего Перевод с английского И. Бочаровой Издательство Знание Москва, 1983 Аугуста Голдин 2 ББК 31.55 Г60 Аугуста Голдин Г60 Океаны энергии.– Пер. с англ.– М.: Знание, 1983.– 144 с, ил. 25 к. 50 000 экз. Книга посвящена промышленному использованию энергии, заключенной в океане. Автор рассказывает о приливных ...»

«Алматы, 2012 1 УДК 911 ББК 26.0 Выпущено по программе Издание социально-важных видов литературы Комитета информации и архивов Министерства культуры и информации Республики Казахстан. Алматинский областной филиал РОО Союз ученых Казахстана Институт Жетысу Рецензенты: д. и. н., профессор А.Н. Марьяшев, М. Акишев Ответственные редакторы: к.ф.н., профессор В.С. Верещагина Казахский текст: М. Акишев Составители: академик НАН РК, д. и. н., профессор К.М. Байпаков, член-корр. АГН РК, д. и. н., ...»

«0 НАУЧНОЕ СООБЩЕСТВО СТУДЕНТОВ XXI СТОЛЕТИЯ. ЕСТЕСТВЕННЫЕ НАУКИ Электронный сборник статей по материалам XVI студенческой международной заочной научно-практической конференции № 2 (16) Февраль 2014 г. Издается с сентября 2012 года Новосибирск 2014 УДК 50 ББК 2 Н 34 Председатель редколлегии: Дмитриева Наталья Витальевна — д-р психол. наук, канд. мед. наук, проф., академик Международной академии наук педагогического образования, врач-психотерапевт, член профессиональной психотерапевтической лиги. ...»

«БЮЛЛЕТЕНЬ НОВЫХ ПОСТУПЛЕНИЙ 2011 г. , 1 КВАРТАЛ 2012 г. Библиотека Иркутской государственной сельскохозяйственной академии Иркутск 2012 Содержание 1. Агрономический факультет. ………………………………………………….2 2. Инженерный факультет. ……………………………………………………….20 3. Общественные кафедры. …………………………………………………….…31 4. Факультет Биотехнологии и ветеринарной медицины………………………38 5. Факультет охотоведения. …………………………………………………….51 6. Экономический факультет. ……………………………………………………62 7. Энергетический ...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РФ ФГБОУ ВПО КУБАНСКИЙ ГОСУДАРСТВЕННЫЙ АГАРНЫЙ УНИВЕРСИТЕТ В. А. Попов Н. В. Островский АГРОКЛИМАТОЛОГИЯ И ГИДРАВЛИКА РИСОВЫХ ЭКОСИСТЕМ Монография Краснодар 2013 УДК 551.5:63:631.674:633.18:574 ББК 40.6 П58 Рецензенты: А. Ч. Уджуху – доктор сельскохозяйственных наук (Всероссийский научно-исследовательский институт риса); Т. И. Сафронова – доктор технических наук, профессор (Кубанский государственный аграрный университет) Попов В. А. П58 Агроклиматология и ...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА И ПРОДОВОЛЬСТВИЯ РЕСПУБЛИКИ БЕЛАРУСЬ ГЛАВНОЕ УПРАВЛЕНИЕ ОБРАЗОВАНИЯ, НАУКИ И КАДРОВ УЧРЕЖДЕНИЕ ОБРАЗОВАНИЯ БЕЛОРУССКАЯ ГОСУДАРСТВЕННАЯ СЕЛЬСКОХОЗЯЙСТВЕННАЯ АКАДЕМИЯ ТЕХНИЧЕСКОЕ ОБЕСПЕЧЕНИЕ АГРОПРОМЫШЛЕННОГО КОМПЛЕКСА Материалы XI Международной научной конференции студентов и магистрантов Научный поиск молодежи XXI века, посвященной 170-летию Белорусской государственной сельскохозяйственной академии (Горки 2-4 декабря 2009г.) Горки 2010 МИНИСТЕРСТВО СЕЛЬСКОГО ...»

«АССОЦИАЦИЯ ПОДДЕРЖКИ БИОЛОГИЧЕСКОГО И ЛАНДШАФТНОГО РАЗНООБРАЗИЯ КРЫМА – ГУРЗУФ-97 КРЫМСКАЯ РЕСПУБЛИКАНСКАЯ АССОЦИАЦИЯ ЭКОЛОГИЯ И МИР РЕСПУБЛИКАНСКИЙ КОМИТЕТ АРК ПО ОХРАНЕ ОКРУЖАЮЩЕЙ ПРИРОДНОЙ СРЕДЫ МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ АРК ТАВРИЧЕСКИЙ НАЦИОНАЛЬНЫЙ УНИВЕРСИТЕТ ИМ. В. И. ВЕРНАДСКОГО ЗАПОВЕДНИКИ КРЫМА – 2007 МАТЕРИАЛЫ IV МЕЖДУНАРОДНОЙ НАУЧНО-ПРАКТИЧЕСКОЙ КОНФЕРЕНЦИИ, ПОСВЯЩЕННОЙ 10-ЛЕТИЮ ПРОВЕДЕНИЯ МЕЖДУНАРОДНОГО СЕМИНАРА ОЦЕНКА ПОТРЕБНОСТЕЙ СОХРАНЕНИЯ БИОРАЗНООБРАЗИЯ КРЫМА (ГУРЗУФ, ...»

«Серия Семейная энциклопедия А. Блейз ЭНЦИКЛОПЕДИЯ ПОЛЕЗНЫХ КОМНАТНЫХ РАСТЕНИЙ Москва ОЛМА-ПРЕСС 2000 ББК 53.59 Я2 Б 68 Исключительное право публикации книги А. Блейз Энциклопедия полезных комнатных растений принадлежит издательству ОЛМА-ПРЕСС. Выпуск произведения без разрешения издательства считается противоправ­ ным и преследуется по закону. Блейз А. Б 68 Энциклопедия полезных комнатных растений. — М.: ОЛМА-ПРЕСС, 2000. — 320 с. — (Семейная энциклопедия). ISBN 5-224-00712-7 Из данной ...»

«Российская академия сельскохозяйственных наук Государственное научное учреждение Всероссийский научно- исследовательский институт кормов имени В. Р. Вильямса Российской академии сельскохозяйственных наук ЭКОЛОГИЧЕСКАЯ СЕЛЕКЦИЯ И СЕМЕНОВОДСТВО КЛЕВЕРА ЛУГОВОГО Результаты 25-летних исследований творческого объединения ТОС Клевер Москва 2012 УДК 633.321.2/.3:631.52.531.02 ББК 42.1 Э 40 Экологическая селекция и семеноводство клевера лугового. Резуль таты 25-летних исследований творческого ...»

«Нина Анатольевна Башкирцева Чистотел от ста болезней Издательство: Крылов, 2008г. ISBN 978-5-9717-0588-8 Введение Если вы услышите, как кто-то рекомендует делать примочки с настоем бородавника, попить желтушник или добавить в ванну отвар золотой травы, не торопитесь покупать в аптеке сразу три упаковки лекарственных трав. Ведь речь идет лишь об одном растении – чистотеле, который народ щедро наградил разными именами. Наверное, нет в нашей стране другого растения, чье название так красноречиво ...»

«У ВэйСииь Энциклопедия целебного чая. - СПб: Издательский Дом Нева, 2005.- 320 с: ил. ISBN 5-7654-4299-4 Новая книга профессора, доктора китайской медицины, академика У ВэйСиня рассказывает об истории культуры чая, о чайных традициях разных стран, а также о технологии производства различных типов чая (белого, зеленого, желтого, красного, черного). Автор описывает лечебные свойства чая и предлагает широкому кругу читателей тысячелетний опыт китайской медицины по применению чая. Предложенная ...»

«Г .Ф. ТАРАНОВ КОРМА И КОРМЛЕНИЕ ПЧЕЛ ИЗДАНИЕ ВТОРОЕ, ПЕРЕРАБОТАННОЕ И ДОПОЛНЕННОЕ МОСКВА РОССЕЛЬХОЗИЗДАТ 1986 ББК 46.91-4 TI9 УДК 638.1.4 ВВЕДЕНИЕ Рецензент — доктор биологических наук Г. А. Аветисян Таранов Г. Ф. Т19 Корма и кормление пчел.— 2-е изд., перераб. и доп.—М.: Россельхозиздат, 1986.— 160 с, ил. В книге приведены сведения об основных кормах пчел (нектаре, кеде, пыльце, перге и их заменителях), их химическом составе и фи* В отличие от большинства сельскохозяйственных жи зиологнческом ...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РФ Федеральное государственное образовательное учреждение высшего профессионального образования Пермская государственная сельскохозяйственная академия имени академика Д.Н. Прянишникова И.А. Самофалова ХИМИЧЕСКИЙ СОСТАВ ПОЧВ И ПОЧВООБРАЗУЮЩИХ ПОРОД Допущено Учебно-методическим объединением вузов Российской Федерации по агрономическому образованию в качестве учебного пособия для студентов, обучающихся по специальностям 110101 Агрохимия и агропочвоведение и 110102 ...»

«РОССИЙСКАЯ АКАДЕМИЯ НАУК СИБИРСКОЕ ОТДЕЛЕНИЕ ЦЕНТРАЛЬНЫЙ СИБИРСКИЙ БОТАНИЧЕСКИЙ САД НОВОСИБИРСКОЕ ОТДЕЛЕНИЕ РУССКОГО БОТАНИЧЕСКОГО ОБЩЕСТВА СОВЕТ БОТАНИЧЕСКИХ САДОВ СИБИРИ И ДАЛЬНЕГО ВОСТОКА — –“—“ –’— —— —–““‹ — –¬—… ‡ ‡ ¬ (‚· , 911 · 2009 „.) Новосибирск 2009 УДК 581.524 + 502.75(063) Проблема и стратегия сохранения биоразнообразия растительного мира Северной Азии: Материалы Всероссийской конференции (Новосибирск, 9–11 сентября 2009 г.). — Новосибирск: Изд-во Офсет, 2009.—288 с. ISBN ...»

«АГРОПРОМЫШЛЕННЫЙ КОМПЛЕКС: КОНТУРЫ БУДУЩЕГО (материалы Международной научно-практической конференции студентов, аспирантов и молодых ученых, г. Курск, 14-16 ноября 2012 г., ч. 3). Курск Издательство Курской государственной сельскохозяйственной академии 2012 УДК 338.43:001 (06) ББК 65.32:72я5 А25 А25 Агропромышленный комплекс: контуры будущего (материалы Международной научно-практической конференции студентов, аспиран тов и молодых ученых, г. Курск, 14-16 ноября 2012 г., ч. 3) [Текст]. – Курск: ...»

«АГРОПРОМЫШЛЕННЫЙ КОМПЛЕКС: КОНТУРЫ БУДУЩЕГО (материалы Международной научно-практической конференции студентов, аспирантов и молодых ученых, г. Курск, 14-16 ноября 2012 г., ч. 1). Курск Издательство Курской государственной сельскохозяйственной академии 2012 УДК 338.43:001 (06) ББК 65.32:72я5 А25 А25 Агропромышленный комплекс: контуры будущего (материалы Международной научно-практической конференции студентов, аспиран тов и молодых ученых, г. Курск, 14-16 ноября 2012 г., ч. 1) [Текст]. – Курск: ...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное государственное бюджетное научное учреждение Российский научно-исследовательский институт информации и технико-экономических исследований по инженерно-техническому обеспечению агропромышленного комплекса (ФГБНУ Росинформагротех) РЕЦИКЛИНГ ОТХОДОВ В АПК Справочник Москва 2011 УДК 628.4 ББК 36.91 Р 45 Рецензенты: Ю.А. Кузнецов, д-р техн. наук, проф., зав. кафедрой (Орловский государственный аграрный университет); В.И. Панферов, ...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РЕСПУБЛИКИ КАЗАХСТАН КАЗАХСКАЯ АКАДЕМИЯ ПИТАНИЯ РЕКОМЕНДАЦИИ для работников сельского хозяйства, производителей пищевой продукции и учреждений общественного питания Алматы, 2012 УДК 613.2.(075) ББК 51.23 я 73 Рекомендовано к изданию Объединенным Ученым советом Казахской Академии питания, Академии профилактической медицины, Национального Центра здорового питания (протокол №5 от 7 августа 2012 г.) Рекомендации посвящены вопросам особенностей питания при ожире нии, ...»









 
© 2013 www.seluk.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.